Information

16.4: In Silico PCR - Biology

16.4: In Silico PCR - Biology


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Using the primer sequences, one can determine the size and/or location of a PCR product. This can be done using BLAST or with a program like UGENE.

Using BLAST

  1. Primers for the PV92 insertion.
    • Forward primer: 5′ GGATCTCAGGGTGGGTGGCAATGCT 3′
    • Reverse primer: 5′ GAAAGGCAAGCTACCAGAAGCCCCAA 3′
  2. Visit BLAST: https://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE_TYPE=BlastSearch.
  3. Paste both primers:
    • GGATCTCAGGGTGGGTGGCAATGCTGAAAGGCAAGCTACCAGAAGCCCCAA
    • Remove the 5′ and 3′ numbers.
  4. Choose “Somewhat Similar”.
    • Locate the locus of the product and the size.

Using Ugene

  1. Exercise using a human D-Loop Primers.
    • Forward Primer 5’-TTAACTCCACCATTAGCACC-3’
    • Reverse Primer 5’-GAGGATGGTGGTCAAGGGAC-3’
  2. Download the sample Genbank file: Human Mitochondrial Genome.
  3. Open the file in Ugene.
  4. Select the “In Silico PCR” button on the far right (double helix button).
    • Insert forward and reverse primers in the appropriate spaces.

5. A PCR product should be noted for one of the sequences after pressing “Find Products anyway“.


DESIGN PCR PRIMERS

BACKGROUND INFORMATION: For sites describing PCR theory, as well as companies marketing PCR products you might want to begin by visiting Highveld. For PCR techniques see PCRlink.com.

There are several excellent sites for designing PCR primers:

Primer3: WWW primer tool (University of Massachusetts Medical School, U.S.A.) &ndash This site has a very powerful PCR primer design program permitting one considerable control over the nature of the primers, including size of product desired, primer size and Tm range, and presence/absence of a 3&rsquo-GC clamp.
GeneFisher - Interactive PCR Primer Design (Universitat Bielefeld, Germany) - a very good site allowing great control over primer design.

Primer3Plus - a new improved web interface to the popular Primer3 primer design program ( Reference: A. Untergasser et al. 2007. Nucl. Acids Res. 35(Web Server issue):W71-W74)
BiSearch Primer Design and Search Tool - this is a useful tool for primer-design for any DNA template and especially for bisulfite-treated genomes. The ePCR tool provides fast detection of mispriming sites and alternative PCR products in cDNA libraries and native or bisulfite-treated genomes. ( Reference: Arányi T et al. 2006. BMC Bioinformatics 7: 431).

Primer-BLAST was developed at NCBI to help users make primers that are specific to the input PCR template. It uses Primer3 to design PCR primers and then submits them to BLAST search against user-selected database. The blast results are then automatically analyzed to avoid primer pairs that can cause amplification of targets other than the input template.

MFEprimer allows users to check primer specificity against genomic DNA and messenger RNA/complementary DNA sequence databases quickly and easily. This server uses a k-mer index algorithm to accelerate the search process for primer binding sites and uses thermodynamics to evaluate binding stability between each primer and its DNA template. Several important characteristics, such as the sequence, melting temperature and size of each amplicon, either specific or non-specific, are reported. ( Reference: Qu W et al. 2012. Nucl. Acids Res. 40 (Web Server issue): W205-W208)

Primer Design and Search Tool

PrimerDesign-M - includes several options for multiple-primer design, allowing researchers to efficiently design walking primers that cover long DNA targets, such as entire HIV-1 genomes, and that optimizes primers simultaneously informed by genetic diversity in multiple alignments and experimental design constraints given by the user. PrimerDesign-M can also design primers that include DNA barcodes and minimize primer dimerization. PrimerDesign-M finds optimal primers for highly variable DNA targets and facilitates design flexibility by suggesting alternative designs to adapt to experimental conditions. ( Reference: Yoon H & Leitner T. 2015. Bioinformatics 31:1472-1474).

RF-cloning (Restriction-free cloning) - is a PCR-based technology that expands on the QuikChange&trade mutagenesis process originally popularized by Stratagene in the mid-1990s, and allows the insertion of essentially any sequence into any plasmid at any location. ( Reference: Bond SR & Naus CC. 2012. Nucl. Acids Res 40(Web Server issue): W209-W213)

primers4clades - is a pipeline for the design of PCR primers for cross-species amplification of novel sequences from metagenomic DNA or from uncharacterized organisms belonging to user-specified phylogenetic lineages. It implements an extended CODEHOP strategy based on both DNA and protein multiple alignments of coding genes and evaluates thermodynamic properties of the oligonucleotide pairs, as well as the phylogenetic information content of predicted amplicons,computed from the branch support values of maximum likelihood phylogenies. Trees displayed on screen make it easy to target primers to interactively selected clades. ( Reference: Contreras-Moreira B et al. 2009. Nucleic Acids Res. 37(Web Server issue):W95-W100).

TaxMan: Inspect your rRNA amplicons and taxa assignments - In microbiome analyses, often rRNA gene databases are used to assign taxonomic names to sequence reads. The TaxMan server facilitates the analysis of the taxonomic distribution of your reads in two ways. First, you can check what taxonomic names are assigned to the sequences produced by your primers and what taxa you will lose. Second, the produced amplicon sequences with lineages in the FASTA header can be downloaded. This can result in a much more efficient analysis with respect to run time and memory usage, since the amplicon sequences are considerably shorter than the full length rRNA gene sequences. In addition, you can download a lineage file that includes the counts of all taxa for your primers and for the used reference. ( Reference: Brandt, B.W. et al. 2012. Nucleic Acids Research 40:W82-W87).

Oligonucleotide physicochemical parameters:

NetPrimer (Premier Biosoft International, U.S.A.) - In my opinion the best site since it provides one with Tm, thermodynamic properties and most stable hairpin & dimers.BUT it takes a while for the program to load.

dnaMATE - calculates a consensus Tm for short DNA sequence (16-30 nts) using a merged method that is based on three different thermodynamic tables. The consensus Tm value is a robust and accurate estimation of melting temperature for short DNA sequences of practical application in molecular biology. Accuracy benchmarks using all experimental data available indicate that the consensus Tm prediction errors will be within 5 ºC from the experimental value in 89% of the cases. ( Reference: A. Panjkovich et al. 2005. Nucl. Acids Res. 33: W570-W572.).

OligoCalc - an online oligonucleotide properties calculator - ( Reference: W.A. Kibbe. 2007. Nucl. Acids Res. 35(Web Server issue):W43-W46)
OligoAnalyzer 3.1 (Integrated DNA Technologies, Inc )
Mongo Oligo Mass Calculator v2.06
OligoEvaluator (Sigma -Aldrich)
Oligo Calculation Tool (Genescript, U.S.A.) - allows modification

PCR primers based upon protein sequence:

If you has the protein sequence and want the DNA sequence the best sites are Protein to DNA reverse translation or Reverse Translation part of the Sequence Manipulation Suite . If you are interested in changing a specific amino acid into another you should consult Primaclade ( Reference: Gadberry MD et al. 2005. Bioinformatics 21:1263-1264).

PCR and cloning:

AMUSER (Automated DNA Modifications with USER cloning) offers quick and easy design of PCR primers optimized for various USER cloning based DNA engineering. USER cloning is a fast and versatile method for engineering of plasmid DNA. This Web server tool automates the design of optimal PCR primers for several distinct USER cloning-based applications. It facilitates DNA assembly and introduction of virtually any type of site-directed mutagenesis by designing optimal PCR primers for the desired genetic changes. ( Reference: Genee HJ et al. 2015. ACS Synth Biol. 4:342-349).

Genomic scale primers: (N.B. also see the JAVA page for additional downloadable programs)

The PCR Suite (Klinische Genetica, Erasmus MC Rotterdam, Netherlands) - this is a suite of four programs based upon Primer3 for genomic primer design. All offer considerable control on primer properties:

Overlapping_Primers - creates multiple overlapping PCR products in one sequence.
Genomic_Primers - designs primers around exons in genomic sequence. All you need is a GenBank file containing your gene.
SNP_Primers - designs primers around every SNP in a GenBank file.
cDNA_Primers - designs primers around open reading frames. Simply upload a GenBank file containing your genes.

Overlapping primer sets:

Two sites offer software is based on the Primer3 program for design overlapping PCR primer pair sets - Multiple Primer Design with Primer 3 and Overlapping Primersets

PHUSER (Primer Help for USER ) - Uracil-Specific Exision Reagent (USER) fusion is a recently developed technique that allows for assembly of multiple DNA fragments in a few simple steps. PHUSER offers quick and easy design of PCR optimized primers ensuring directionally correct fusion of fragments into a plasmid containing a customizable USER cassette. The primers have similar annealing temperature (Tm). PHUSER also avoids identical overhangs, thereby ensuring correct order of assembly of DNA fragments. All possible primers are individually analysed in terms of GC content, presence of GC clamp at 3'-end, the risk of primer dimer formation, the risk of intra-primer secondary structures and the presence of polyN stretches. ( Reference: Olsen LR et al. 2011. Nucl. Acids Res. 39 (Web Server issue): W61-W70)

Primerize is a Web Server for primer designs of DNA sequence PCR assembly. Primerize is optimized to reduce primer boundaries mispriming, is designed for fixed sequences of RNA problems, and passed wide and stringent tests. This efficient algorithm is suitable for extended use such as massively parallel mutagenesis library. ( Reference: Tian, S., & Das, R. (2016) Quarterly Review of Biophysics 49(e7): 1-30).

Short interfering RNA (siRNA) design:

Small interfering RNA (siRNA) guides sequence-specific degradation of the homologous mRNA, thus producing "knock-down" cells. siRNA design tool scans a target gene for candidate siRNA sequences that satisfy user-adjustable rules. A variety of servers exist:

siRNA Design Software - compares existing design tools, including those listed above. They also attempt to improve the MPI principles and existing tools by an algorithm that can filter ineffective siRNAs. The algorithm is based on some new observations on the secondary structure. ( Reference: S. M. Yiu et al. (2004) Bioinformatics 21: 144-151).

OligoWalk is an online server calculating thermodynamic features of sense-antisense hybidization. It predicts the free energy changes of oligonucleotides binding to a target RNA. It can be used to design efficient siRNA targeting a given mRNA sequence. ( Reference: Lu ZJ & Mathews DH. 2008. Nucl. Acids Res. 36: 640-647).

VIRsiRNApred - a human viral siRNA efficacy prediction server (Reference: Qureshi A et al. 2013. J Transl Med. 11:305).

Dicer-substrate siRNAs (DsiRNAs) are chemically synthesized 27-mer duplex RNAs that have increased potency in RNA interference compared to traditional siRNAs.RNAi DESIGN (IDT Integrated DNA Technologies)

pssRNAit - Designing effective and specific plant RNAi siRNAs with genome-wide off-target gene assessment.

DSIR is a tool for siRNA (19 or 21 nt) and shRNA target design. ( Reference: Vert JP et al. 2006. BMC Bioinformatics 7:520).

Imgenex siRNA retriever program has been designed to select siRNA encoding DNA oligonucleotides that can be cloned into one of the pSuppressor vectors. The input sequence can be directly accessed from a Genbank accession or sequence provided by the researcher.

siDRM is an implementation of the DRM rule sets for selecting effective siRNAs. The authors have performed an updated analysis using the disjunctive rule merging (DRM) approach on a large and diverse dataset compiled from siRecords, and implemented the resulting rule sets in siDRM, a new online siRNA design tool. siDRM also implements a few high-sensitivity rule sets and fast rule sets, links to siRecords, and uses several filters to check unwanted detrimental effects, including innate immune responses, cell toxic effects and off-target activities in selecting siRNAs. ( Reference: Gong W et al. 2008. Bioinformatics 24:2405-2406).

siMAX siRNA Design Tool (Eurofins Genomic, Germany) - is a proprietary developed software designed to help you selecting the most appropriate siRNA targeting your gene(s) of interest.

shRNA Designer (Biosettia Inc., USA) - Use this program to design shRNA oligos that are compatible with our SORT-A/B/C vectors. The design tool provides targets with the greatest chance of knocking down your gene. Please note, only one oligo is designed as it is palindromic.

siDESIGN Center (Horizon Discovery Ltd., UK) - is an advanced, user-friendly siRNA design tool, which significantly improves the likelihood of identifying functional siRNA. One-of-a-kind options are available to enhance target specificity and adapt siRNA designs for more sophisticated experimental design.

Realtime PCR primer design:

RealTimeDesign (Biosearch Technologies) - free but requires registration.

GenScript Real-time PCR (TaqMan) Primer Design - one can customize the potential PCR amplicon's size range, Tm (melting temperature) for the primers and probes, as well as the organism. You can also decide how many Primer/Probe sets you want the tool to return to you. It is possible to use a GenBank accession number as the template.

QuantPrime - is a flexible program for reliable primer design for use in larger qPCR experiments. The flexible framework is also open for simple use in other quantification applications, such as hydrolyzation probe design for qPCR and oligonucleotide probe design for quantitative in situ hybridization. ( Reference: S. Arvidsson et al. 2008. BMC Bioinformatics 9:465)

PrimerQuest - (IDT, USA)

Introduction of mutations:

WatCut (Michael Palmer, University of Waterloo, Canada) - takes an oligonucleotide and introduces silent mutations in potential restriction sites such that the amino acid sequence of the protein is unaltered.

PrimerX - can be uused to automate the design of mutagenic primers for site-directed mutagenesis. It is available in two flavours (a) Primer Design Based on DNA Sequence and (b) Primer Design Based on Protein Sequence

Primerize-2D - is designed to accelerate synthesis of large libraries of desired mutants through design and efficient organization of primers. The underlying program and graphical interface have been experimentally tested in our laboratory for RNA domains with lengths up to 300 nucleotides and libraries encompassing up to 960 variants. ( Reference: Tian, S., & Das, R. (2017) Bioinformatics 33(9): 1405-1406).

When you are ready to set-up your PCR reaction see:

PCR Box Titration Calculator (Allotron Biosensor Corporation) - for figuring out the amounts of each reagent to use in a two-dimensional box titration for PCR. For standard PCR reactions adjust volume, and change "row" and "column" number to "1", click on all the "top" or "bottom" and "done". PCR Titration Calculator (Angel Herráez Cybertory: virtual molecular biology lab Universidad de Alcalá, Spain) is a similar site.

PCR Reaction Mixture Setup (R. Kalendar, University of Helsinki, Finland) - very nice site (requires Java).

PCR Optimization (Bioline, United Kingdom) - a lot of conditions

Primer presentation on the DNA sequence:

Sequence Extractor (Paul Stothard) - generates a clickable restriction map and PCR primer map of a DNA sequence (accepted formats are: raw, GenBank, EMBL, and FASTA) offering a great deal of control on output. Protein translations and intron/exon boundaries are also shown. Use Sequence Extractor to build DNA constructs in silico.


Background

The ability to derive genome-wide mRNA expression data from a population of cells has proven useful in thousands of studies over the past two decades. In spite of their utility, traditional expression experiments are limited to providing measurements that are averaged over thousands of cells, which can mask or even misrepresent signals of interest. Fortunately, recent technological advances now allow us to obtain transcriptome-wide data from individual cells. This development is not simply one more step toward better expression profiling, but rather a major advance that will enable fundamental insights into biology.

While the data obtained from single-cell RNA-sequencing (scRNA-seq) are often structurally identical to those from a bulk expression experiment (some K million mRNA transcripts are sequenced from n samples or cells), the relative paucity of starting material and increased resolution give rise to distinct features in scRNA-seq data, including an abundance of zeros (both biological and technical), increased variability, and complex expression distributions (Fig. 1). These features, in turn, pose both opportunities and challenges for which novel statistical and computational methods are required.

Prominent features in single-cell RNA-seq data relative to bulk RNA-seq include an abundance of zeros, increased variability, and multi-modal expression distributions. a Boxplots of the gene-specific proportion of zeros in a bulk (bulk1) and single-cell (sc1) dataset stratified by percentile of median gene expression. Sequencing depth ranges from 420,000 to 16.6 million in bulk1 and 385,000 to 16.4 million in sc1 (samples were chosen to have comparable depths see the “Data” section). b Densities of gene-specific log variance for all genes in three bulk and three single-cell RNA-seq datasets. Densities are also shown for the single-cell datasets for log variances calculated following the removal of zeros, emphasizing that the increased variability observed relative to bulk is not entirely due to the presence of zeros. c For each dataset shown in b, 1000 genes were selected at random from the list of genes for which at least 75 % of cells showed non-zero expression. For each gene, zeros were removed and Mclust [92] was applied to log expression to estimate the number of modes. Because zeros were removed prior to Mclust, a mode at zero will not contribute to the total number of modes shown

In this review, we discuss such statistical and computational methods in detail. We begin with an overview of practices for robust experimental design, quality control, and expression estimation, where the principles and methods used in bulk experiments, perhaps slightly modified, apply directly. We then discuss methods for normalization, noting that features that are unique to scRNA-seq pose challenges for existing approaches. Methods developed for downstream analysis are also considered with specific focus on methods for clustering and sub-population identification, assessing differences in gene expression across conditions, pseudotime ordering, and network reconstruction (a summary is provided in Table 1). We conclude with a discussion of the open questions facing computational scientists, as well as those that will soon arise as datasets quickly become ever larger and more complex.


INTRODUCTION

Preeclampsia (PE) is a complicated disorder, which only happens during pregnancy. It is commonly diagnosed by detecting the new onset of hypertension (blood pressure ≥ 140/90) with coexisting proteinuria (≥300 mg/24 h) after 20 weeks of gestation 1 . Because PE is naturally heterogeneous, there are no clear findings on its exact pathological mechanism. However, many theories have been proposed as the pathophysiological mechanism of this complication. According to some of these theories, oxidative stress, immunologic intolerance, and angiogenic imbalance are identified as the significant causes of PE. Although these theories are divers, all of them agree on one common item, namely the placenta. It is believed that the placenta is actively involved in PE pathogenesis because its presence is vital for the development of the disease, and the placenta delivery is the only known treatment 2 .

Evidences showed aberrant expression of various genes in placentas complicated with PE 3 . LncRNAs are classified into antisense transcripts, promoter-associated, long intergenic RNA and intronic transcript, and have more than 200 nucleotides length. Previous researches have revealed the role of lncRNAs in different steps of gene expression, such as mRNA splicing and translation, imprinting, epigenetic and transcriptional regulation, chromosome dosage compensation, and nuclear cytoplasmic trafficking. Evidences indicated several lncRNAs that expressed differentially in preeclamptic and normal placentas. Therefore, irregular expression of lncRNAs may lead to dysregulated expression of their target genes, leading to abnormal function of placenta, resulting in preeclamptic placentas with unusual biological events 4 .

HOTAIR gene mapped on chromosome 12q13.13 comprises a 2,158-nuleotide length is transcribed from within antisense strand of the HOXC cluster 5 . HOTAIR can play a major role in epigenetic regulation through the modification of chromatin structure 6 . Moreover, HOTAIR acts significant role in regulation of the several genes involving in diverse processes, including apoptosis, cell cycle, cell migration, invasion, metastases in cancers and trophoblast cells proliferation and invasion 5, 7, 8 .

To date, genetic variants in HOTAIR gene were found to be linked with congenital heart disease (CHD) 9 , noise-induced hearing loss 10 , and cancers 11-14 . However, there appears to be no published data regarding the possible role of HOTAIR variants and PE risk. Hence, the current study aimed to explore the possible role of HOTAIR variants on PE susceptibility followed by in silico analyses.


RT-PCR primer design and in silico PCR - (Jul/06/2008 )

However, when I go for in silico PCR tool (UCSC), the results showed no potential amplicon of my target ? So, what can I do? My aim is just would like to check the present or absent of mRNA expression ..

If any of your primers is located on two exons (on the exon-exon junction), in silico PCR won't return any hit in most cases. If both primers are entirely within exons (two different exons, of course), you should get hits. You can use the PCR products returned by primer3 to do a blat search to see where your primers are located.

Thanks for your explanation . Hmm, I knew my primers location by using a sequencer software. However, I failed to amplify cDNA using primers desinged on the exon-exon junction last week. So, I thought can use in silico PCR to check whether can I amplify the cDNA target region, but it seems I was wrong.

May I know how can I confirm the primers whether can work or not? My target region (cDNA) consists of 4 exon, total size is around 500 bp. Can I employ multiplex PCR to amplify all four fragments in order to save template (cDNA commercial available)'s volume ?

If you are sure the mRNA sequence you used for primer disign in Primer3 is right, and you didn't get pcr product, the likely reason is that the gene expression is too low. You really need a positive control cDNA sample (for example from cell lines that express high of your gene) to tell you the primers are OK. You don't need to do multiplex PCR.


Run PCR in silico

Create primers on Benchling either manually or using the Primer Wizard.

Open your sequence and open the Primer panel on the right nav bar.

Link the primer pair that you'd like to use in your PCR reaction. To link two primers as a pair, use CTRL or SHIFT + Click to multi-select your two primers from the panel or the sequence map.

Right click the highlighted section between the two primers on the sequence map to access the Link Primers option.

Note: If you created primer pairs using the Wizard, they will automatically be linked.

Next, click on the Pairs tab on the Primers panel, select your Primer pair, and then select Create PCR Product.

Set your desired options on the next screen these will help determine what your new sequence looks like in Benchling.

Click Copy to save the final PCR product/sequence to a project and folder.


PCR and multiplex PCR assays for the detection of Cronobacter species using specific targets obtained by a bioinformatics approach

Cronobacter species are opportunistic pathogens associated with severe infections in immunocompromised individuals. Species differentiation is essential as the sensitivity of different species to chemical reagents, antibiotics, and virulence factors may be diverse. This study aimed to mine new molecular targets for the detection of Cronobacter strains at the species level. Using a bioinformatics approach and the online BLAST software, we obtained serial Cronobacter species-specific target genes. Primers for the selected genes were constructed, and the PCR products were evaluated using various Cronobacter species and non-Cronobacter strains. As a result, 2, 5, 7, and 5 specific target genes were found for C. sakazakii, C. malonaticus, C. dublinensis, and C. turicensis, respectively. Thereafter, 4- and 5-multiplex PCR (mPCR) was successfully developed to identify these four species based on the validated species-specific primers. Overall, our data indicated that PCR and mPCR assays have excellent specificity and sensitivity for the detection of Cronobacter species, suggesting the potential of their use in food inspection and clinical diagnosis.


Abstract

Background & objective

Epidermal growth factor receptor (EGFR) signaling pathway is one of the promising and well-established targets for anticancer therapy. The objective of the present study was to identify new EGFR inhibitors using ligand and structure-based drug designing methods, followed by a synthesis of selected inhibitors and evaluation of their activity.

Methods

A series of C-7-hydroxyproton substituted chrysin derivatives were virtually drawn to generate a small compound library that was screened using 3D QSAR model created from forty-two known EGFR tyrosine kinase inhibitors. Next, the obtained hits with fitness score ≥ 1.0 were subjected to molecular docking analysis. Based on the predicted activity and XP glide score, three EGFR inhibitors were synthesized and characterized using 1 H-NMR, 13 C-NMR and MS. Finally, comparative in vitro investigation of the biological activity of synthesized inhibitors was performed with that of the parent molecule, chrysin.

Results

The data depicted a 3.2–fold enhanced cytotoxicity of chrysin derivative, CHM-04 against breast cancer cells as compared with chrysin as well as its binding with EGFR protein. Furthermore, the biological activity of CHM-04 was comparable to the standard EGFR inhibitor, AG1478 in increasing apoptosis and decreasing the migratory potential of triple-negative breast cancer cells as well as significantly lowering the mammosphere forming ability of breast cancer stem cells.

Conclusion

The present study suggests CHM-04, an EGFR inhibitor possessing drug-like properties as a plausible therapeutic candidate against breast cancer.


REAGENTS AND SOLUTIONS

HEK293T growth medium (565 ml)

  • 500 ml DMEM (Gibco 11965-092)
  • 5 ml 100 mM sodium pyruvate (Gibco 11360070)
  • 5 ml 100× L -glutamine (Gibco 25030081)
  • 50 ml fetal bovine serum (VWR 89510186)
  • 5 ml Pen/Strep (Gibco 15140122)

SDS buffer (Laemmli buffer), 5×

  • 312.5 mM Tris·Cl, pH 6.8
  • 10% SDS
  • 50% (w/v) glycerol
  • 0.05% bromophenol blue
  • Store at room temperature
  • Dilute 5× SDS buffer with water to 2×, and add 50 μl 2-mercaptoethanol per ml of 2× SDS sample buffer prior to use. The 2× SDS sample buffer with 2-mercaptoethanol can be stored at −20°C.

Tris/acetate/EDTA (TAE) buffer, pH 7.2, 50×

  • 2 M Tris base
  • 1 M sodium acetate
  • 50 mM EDTA
  • Adjust pH to 7.2 with acetic acid and store at room temperature.
  • Prepare 1× working solution by diluting in double-distilled water.

Primer Design using Software

A number of primer design tools are available that can assist in PCR primer design for new and experienced users alike. These tools may reduce the cost and time involved in experimentation by lowering the chances of failed experimentation.

Primer Premier follows all the guidelines specified for PCR primer design. Primer Premier can be used to design primers for single templates, alignments, degenerate primer design, restriction enzyme analysis. contig analysis and design of sequencing primers.

The guidelines for qPCR primer design vary slightly. Software such as AlleleID and Beacon Designer can design primers and oligonucleotide probes for complex detection assays such as multiplex assays, cross species primer design, species specific primer design and primer design to reduce the cost of experimentation.

PrimerPlex is a software that can design primers for Multiplex PCR and multiplex SNP genotyping assays.


Watch the video: Digital PCR Using the Bio-Rad QX100 ddPCR System (May 2022).